Sequence ID | >W1910571163 |
Genome ID | JJQD01000052 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina mazei 1.F.A.2.8 [JJQD] |
Start position on genome | 29587 |
End posion on genome | 29676 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taatcgaaaT |
tRNA gene sequence |
GCGAGGGTTGCCCAGCCAGGTCAAAGGCGCTAGGTTGAGGGCCTAGTTTCGTAGGAATTC |
Downstream region at tRNA end position |
Agactttttt |
Secondary structure (Cloverleaf model) | >W1910571163 Leu GAG T ATCC Agactttttt G - C C - G G - C A - T G - C G - C G - C T A T T A C C C A C C G A T + | | | | G A C C C G G T G G G C G | | | T T G A G G C T C A A G TTTCGTAGGAATTC C - G T - A A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |