Sequence ID | >W1910571325 |
Genome ID | JJQG01000092 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina mazei 1.H.A.1A.1 [JJQG] |
Start position on genome | 14633 |
End posion on genome | 14717 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tccgaaaagc |
tRNA gene sequence |
GCGGGAGTAACCAAGCGGTCAACGGTGGCAGACTCAAGATCTGTTCGTGCAGACGTTCAG |
Downstream region at tRNA end position |
gaaattctcg |
Secondary structure (Cloverleaf model) | >W1910571325 Leu CAA c ACCt gaaattctcg G - C C - G G - C G - C G - C A - T G - C T A T T T C C C A C G A A | + | | | G G A C C A A G G G G C G | | | T T T C G G T C A A G TCGTGCAGACGTTC G + T C - G A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |