| Sequence ID | >W1910572511 |
| Genome ID | JMIO01000017 |
| Phylum/Class | Euryarchaeota |
| Species | Methanoculleus sp. MH98A [JMIO] |
| Start position on genome | 31236 |
| End posion on genome | 31165 |
| Amino Acid | Ala |
| Anticodon | CGC |
| Upstream region at tRNA start position |
tcatatcttc |
| tRNA gene sequence |
GGGCTCGTAGATCAGGGGTAGATCGCTACGTTCGCAACGTAGAGGCCGCGGGTTCAAATC |
| Downstream region at tRNA end position |
gttctttatt |
| Secondary structure (Cloverleaf model) | >W1910572511 Ala CGC
c Atcg gttctttatt
G - C
G - C
G + T
C - G
T + G
C - G
G - C T A
T C G C C C A
G A A | | | | | A
G C T A G G C G G G C
G | | | | T T
G G A T C
T A G AGGCC
C - G
T - A
A - T
C - G
G - C
T A
T A
C G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |