Sequence ID | >W1910572956 |
Genome ID | JNVL01000002 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Marine Group I thaumarchaeote SCGC AAA799-E16 [JNVL] |
Start position on genome | 40577 |
End posion on genome | 40651 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
catttttagt |
tRNA gene sequence |
GGGTCTATGGCGCAGCCAGGTAGCGCACAGGACTCTTAATCCTGCTGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
tttaaattct |
Secondary structure (Cloverleaf model) | >W1910572956 Lys CTT t GCtt tttaaattct G - C G - C G - C T - A C - G T - A A - T T A T C T C C C A C G A G | | | | G C C G C G G T G G G C A | | | | T T G G C G C G T A A CTGTC C - G A - T G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |