Sequence ID | >W1910572968 |
Genome ID | JNVL01000025 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Marine Group I thaumarchaeote SCGC AAA799-E16 [JNVL] |
Start position on genome | 2026 |
End posion on genome | 1953 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
actgactaaa |
tRNA gene sequence |
GCGGAGTTAGTTTAGTCTGGTATGACGTCAGCTTCCCAAGCTGAAGGCCGCGGGTTCAAA |
Downstream region at tRNA end position |
taattcacga |
Secondary structure (Cloverleaf model) | >W1910572968 Gly CCC a Atta taattcacga G - C C - G G - C G - C A - T G - C T - A T A T C G C C C A T G A A | | | | | A C T T T G G C G G G C T + | | T T G T G A C G T A G AGGCC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |