Sequence ID | >W1910572991 |
Genome ID | JOKN01000020 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Marine Group I thaumarchaeote SCGC AAA799-N04 [JOKN] |
Start position on genome | 7991 |
End posion on genome | 7915 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aggatttact |
tRNA gene sequence |
GGGATCGTGGTCTAGCTTGGTATGATTCTGCGTTTGGGACGCAGAGGTCGCGCGTTCAAA |
Downstream region at tRNA end position |
ttatcttatt |
Secondary structure (Cloverleaf model) | >W1910572991 Pro TGG t ACCA ttatcttatt G - C G - C G - C A - T T - A C - G G - C T A T C G C T C A C G A G | | | | A T T C T G G C G C G C T | | + T T G T G A T G T A T AGGTC C - G T - A G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |