Sequence ID | >W1910573302 |
Genome ID | JOTD01000036 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Marine Group I thaumarchaeote SCGC RSA3 [JOTD] |
Start position on genome | 8771 |
End posion on genome | 8697 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tttggattaa |
tRNA gene sequence |
GCTCCTATAGTGTAGTCCGGTTAAGCATACAGCCCTCTCAAGGCTGTGACCCGGGTTCAA |
Downstream region at tRNA end position |
acattctggt |
Secondary structure (Cloverleaf model) | >W1910573302 Glu CTC a Attg acattctggt G - C C - G T - A C - G C - G T + G A - T T A T G G C C C A C T G A A | | | | | A C T G T G C C G G G C G + | | + T T G G C A T T T A A A TGAC C - G A - T G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |