Sequence ID | >W1910574182 |
Genome ID | JPVY01000014 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Thalassospira lucentensis MCCC 1A00383 = DSM 14000 [JPVY] |
Start position on genome | 49103 |
End posion on genome | 49179 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
atggatttgc |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCGTTCGCTTGACATGCGAGAGGTCACAAGTTCGAG |
Downstream region at tRNA end position |
tctttcacac |
Secondary structure (Cloverleaf model) | >W1910574182 Val GAC c ACCA tctttcacac G - C G - C G - C C - G C - G T - A A - T T G T T G T T C A T G A A | | | | | G T C T C G A C A A G C G | | | | T T G G A G C T T A G AGGTC T + G T - A C - G G - C C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |