Sequence ID | >W1910576082 |
Genome ID | JRZZ01000042 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Erwinia sp. B116 [JRZZ] |
Start position on genome | 24002 |
End posion on genome | 24078 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gggcagattt |
tRNA gene sequence |
CGGCACGTAGCGCAGCCTGGTAGCGCACCGTCATGGGGTGGCGGGGGTCGAGAGTTCGAA |
Downstream region at tRNA end position |
aaacgtttaa |
Secondary structure (Cloverleaf model) | >W1910576082 Pro GGG t ACCA aaacgtttaa C - G G - C G - C C - G A - T C - G G - C T A T C T C T C A C G A A | | | | | G C C G C G G A G A G C T | | | | T T G G C G C G T A A GGGTC C - G C - G G - C T + G C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |