Sequence ID | >W1910583889 |
Genome ID | JXRJ01000007 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lacticaseibacillus paracasei INF 448 [JXRJ] |
Start position on genome | 25556 |
End posion on genome | 25482 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
acatactcaT |
tRNA gene sequence |
TGCCCAGTAGTTCAGTGGTAGAATGCTTGACTGTTAATCAAAGGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
aaagctgtga |
Secondary structure (Cloverleaf model) | >W1910583889 Asn GTT T GTCg aaagctgtga T - A G - C C - G C - G C - G A - T G - C T A T C G A C C A G A A | | | | | G T C T T G G C T G G C G | | | + T T G G A A T T A G GGGTC C A T - A T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |