Sequence ID | >W1910584007 |
Genome ID | JXRL01000109 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lacticaseibacillus paracasei INF 10 [JXRL] |
Start position on genome | 2875 |
End posion on genome | 2788 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
cttgtgtttt |
tRNA gene sequence |
GGAGAGTTGGCAGAGTGGTAATGCAACGGACTCGAAATCCGTCGAACCGGCTAATACCGG |
Downstream region at tRNA end position |
tatttcaata |
Secondary structure (Cloverleaf model) | >W1910584007 Ser CGA t Ttat tatttcaata G - C G - C A - T G - C A - T G - C T - A T A T T G T C C A G A G + | | | | A T G A C G G C A G G C G | | | T T G A T G C T A A CGAACCGGCTAATACCGGCGC A - T C - G G - C G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |