Sequence ID | >W1910584234 |
Genome ID | JXTF01000038 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Roseovarius sp. JS7-11 [JXTF] |
Start position on genome | 6259 |
End posion on genome | 6183 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ccgccctcac |
tRNA gene sequence |
GCGCTGGTAGCTCAGTTGGATAGAGTACTTGACTACGAATCAAGGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ttgaaaaggc |
Secondary structure (Cloverleaf model) | >W1910584234 Arg ACG c GCCA ttgaaaaggc G - C C - G G - C C - G T - A G - C G - C T A T C C T C C A T G A A | | + | | G T C T C G G G G G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |