Sequence ID | >W1910584447 |
Genome ID | JXUA01000011 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter coli SH-CCH11C211 [JXUA] |
Start position on genome | 28364 |
End posion on genome | 28290 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ttttaaaagt |
tRNA gene sequence |
GGCCCATTCGTCTAGCGGTTAGGACATCGCCCTTTCACGGCGGTAACACGAGTTCGAGTC |
Downstream region at tRNA end position |
cttaaatcct |
Secondary structure (Cloverleaf model) | >W1910584447 Glu TTC t ACCA cttaaatcct G - C G + T C - G C - G C - G A - T T - A T G T T G C T C A C G A C | | | | | G G T C T G A C G A G C G + | | | T T T G G A C T A A TAAC T + G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |