Sequence ID | >W1910597283 |
Genome ID | LANF01000011 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Palaeococcus ferrophilus DSM 13482 [LANF] |
Start position on genome | 102558 |
End posion on genome | 102481 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccctaaacgg |
tRNA gene sequence |
GGGCCGGTAGCTCAGCCTGGTTAGAGCACCGGGCTTTTAACCCGGTGGTCCCGGGTTCGA |
Downstream region at tRNA end position |
caaaactccg |
Secondary structure (Cloverleaf model) | >W1910597283 Lys TTT g GCCA caaaactccg G - C G - C G - C C - G C - G G - C G - C T A T G G C C C A C C G A A | | | | | G T C T C G C C G G G C G | | | | T T G G A G C T T A A TGGTC C - G C - G G - C G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |