Sequence ID | >W1910613018 |
Genome ID | LGQU01000147 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Azospirillum sp. TSH20 [LGQU] |
Start position on genome | 10048 |
End posion on genome | 10122 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gggttcccgt |
tRNA gene sequence |
GGTCTCGTAGCTCAGCGGGAGAGCACTACGTTGACATCGTAGGGGTCACTGGTTCAATCC |
Downstream region at tRNA end position |
ttctgaaggc |
Secondary structure (Cloverleaf model) | >W1910613018 Val GAC t ACCA ttctgaaggc G - C G - C T - A C - G T + G C - G G - C C T T T G A C C A G A A | | | | | A C C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |