Sequence ID | >W1910617573 |
Genome ID | LIST01000006 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorubrum tropicale 5 [LIST] |
Start position on genome | 20587 |
End posion on genome | 20657 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ctcgacttga |
tRNA gene sequence |
GCACCGTTGGTCCAGTGGTAGGACATTAGCTTCCCAAGCTAATAGCCCGGGTTCAATTCC |
Downstream region at tRNA end position |
ctgcggcgaa |
Secondary structure (Cloverleaf model) | >W1910617573 Gly CCC a Attc ctgcggcgaa G - C C - G A - T C - G C - G G - C T - A T T T G G C C C A G A G | | | | | A T C C T G C C G G G C G | | | | T T G G G A C T A A TAGC T - A T - A A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |