Sequence ID | >W1910623442 |
Genome ID | LKKZ01000004 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Listeria monocytogenes FNW19G43 [LKKZ] |
Start position on genome | 115554 |
End posion on genome | 115464 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gccattttcT |
tRNA gene sequence |
GGAGAGCTGTCCGAGTGGCCGAAGGAGCACGGTTGGAAACCGTGTAGGCGGTGTAAGCTG |
Downstream region at tRNA end position |
acacataata |
Secondary structure (Cloverleaf model) | >W1910623442 Ser GGA T GTtt acacataata G - C G - C A - T G - C A - T G - C C - G T A T T T C C C A T G A G | | | | | G G G C C T A A G G G C G | | | T T C A G G A C G A G TAGGCGGTGTAAGCTGTCTC C - G A - T C - G G - C G - C T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |