Sequence ID | >W1910645182 |
Genome ID | LVDK01000003 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Shewanella algae SYT4 [LVDK] |
Start position on genome | 14351 |
End posion on genome | 14275 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tcaaatctta |
tRNA gene sequence |
CGGTGATTAGCGCAGCCTGGTAGCGCATCTGCTTTGGGAGCAGAGGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
aatttgattt |
Secondary structure (Cloverleaf model) | >W1910645182 Pro TGG a ACCA aatttgattt C - G G - C G - C T - A G - C A - T T - A T A T T C T C C A C G A A | | | | | G C C G C G A G A G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |