Sequence ID | >W1910647542 |
Genome ID | LXWN01000002 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Candidatus Nitrosopelagicus brevis brevis U25 [LXWN] |
Start position on genome | 447326 |
End posion on genome | 447399 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aatcgttcgt |
tRNA gene sequence |
GCCTCGATAGCTCAGCCTGGTAGAGCATTTCACTCGTAATGAAAAGGTCGTGGGTTCGGA |
Downstream region at tRNA end position |
atttcttaat |
Secondary structure (Cloverleaf model) | >W1910647542 Thr CGT t Ttta atttcttaat G - C C - G C - G T - A C - G G - C A - T T A T C A C C C G C G A A | | | | | G C C T C G G T G G G C T | | | | T T G G A G C G T A A AGGTC T - A T - A T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |