Sequence ID | >W1910657525 |
Genome ID | MASH01000133 |
Phylum/Class | Gammaproteobacteria |
Species | Arsenophonus endosymbiont of Bemisia tabaci of Bemisia tabaci Asia II 3 [MASH] |
Start position on genome | 6771 |
End posion on genome | 6858 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tccgcgccat |
tRNA gene sequence |
GGAAGGATGGCCGAGCGGTCGAAGGCAGCGGTCTTGAAAACCGCCGATGGGAAACCATCC |
Downstream region at tRNA end position |
aatttgccgg |
Secondary structure (Cloverleaf model) | >W1910657525 Ser TGA t GCCA aatttgccgg G - C G - C A - T A - T G - C G - C A - T T A T A T C T C A C G A G | | | | | G G G C C G T A G A G C G | | | T T T A G G C C G A A CGATGGGAAACCATCC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |