Sequence ID | >W1910663922 |
Genome ID | MBPK01000042 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Helicobacter winghamensis 295_13 [MBPK] |
Start position on genome | 73512 |
End posion on genome | 73596 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
taatttttgg |
tRNA gene sequence |
GGTGAGATACTCAAGTGGCCAACGAGGGCAGACTGTAAATCTGCTGTTTCTGACTTCCGT |
Downstream region at tRNA end position |
tagccatgcg |
Secondary structure (Cloverleaf model) | >W1910663922 Tyr GTA g ACCA tagccatgcg G - C G - C T - A G - C A - T G - C A - T T A T G C A C C A T G A A | | | | | G G A C T C C G T G G C G | | | T T C C G A G C A A G TGTTTCTGACTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |