Sequence ID | >W1910678377 |
Genome ID | MCUR01000065 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio cyclitrophicus 10N.286.49.E10 [MCUR] |
Start position on genome | 3470 |
End posion on genome | 3556 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
taattgcgtt |
tRNA gene sequence |
GCCCTGGTGGTGGAATTGGTAGACACAAGGGATTTAAAATCCCTCGGCGTTCGCGCTGTG |
Downstream region at tRNA end position |
tctatttagt |
Secondary structure (Cloverleaf model) | >W1910678377 Leu TAA t ACCA tctatttagt G - C C - G C - G C - G T + G G - C G - C T G T C G G C C A T A A G | | | | | A T G G T G G C C G G C G | | | T T G A C A C T A G A CGGCGTTCGCGCTGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |