Sequence ID | >W1910682565 |
Genome ID | MCWX01000027 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio lentus 10N.261.55.B3 [MCWX] |
Start position on genome | 2442 |
End posion on genome | 2367 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aacaatcaat |
tRNA gene sequence |
TCCCCTTTAGTTCAGTTGGTAGAACGGCGGACTGTTAATCCGTATGTCGCAAGTTCAAGT |
Downstream region at tRNA end position |
attagaaaag |
Secondary structure (Cloverleaf model) | >W1910682565 Asn GTT t GCCA attagaaaag T - A C - G C - G C - G C - G T - A T - A T G T C G T T C A T G A A | | | | | A T C T T G G C A A G C G | | | | T T G G A A C T A G ATGTC G + T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |