Sequence ID | >W1910688266 |
Genome ID | MCZY01000011 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio lentus 10N.261.45.E3 [MCZY] |
Start position on genome | 201718 |
End posion on genome | 201642 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tcacagcatt |
tRNA gene sequence |
GCCCGCTTAGCTCAGTTGGTTAGAGTACTTGCATGACATGCAAGGTGTCACTGGTTCGAG |
Downstream region at tRNA end position |
gattcgttct |
Secondary structure (Cloverleaf model) | >W1910688266 Val GAC t ACCA gattcgttct G - C C - G C - G C - G G - C C - G T - A T G T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | + T T G G A G T T T A A GTGTC C - G T - A T - A G - C C - G A T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |