Sequence ID | >W1910689598 |
Genome ID | MDAP01000010 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio cyclitrophicus 10N.222.54.F11 [MDAP] |
Start position on genome | 168 |
End posion on genome | 84 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aaaacaccct |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGAGCAGACTGTAAATCTGCCGGCACTGCCTTCGAT |
Downstream region at tRNA end position |
tattcttctt |
Secondary structure (Cloverleaf model) | >W1910689598 Tyr GTA t ACCA tattcttctt G - C G - C A - T G - C G - C G - C G + T T A T C T G C C A T G A T | | + | | G G G C C C G A T G G C G | | | T T C A G G G C A A A CGGCACTGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |