| Sequence ID | >W1910697320 |
| Genome ID | MEKO01000021 |
| Phylum/Class | Acidobacteriota |
| Species | Acidobacteria bacterium RIFCSPHIGHO2_12_FULL_67_30 [MEKO] |
| Start position on genome | 8917 |
| End posion on genome | 8841 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
gcttgccggt |
| tRNA gene sequence |
GGGCGTATAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGTGGTTCGAA |
| Downstream region at tRNA end position |
caacgtgggg |
| Secondary structure (Cloverleaf model) | >W1910697320 Ile GAT
t ACCA caacgtgggg
G - C
G - C
G - C
C - G
G - C
T - A
A - T T A
T C C A C C A
T G A A | | | | | G
T C T C G G G T G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
C - G
C - G
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |