Sequence ID | >W1910697840 |
Genome ID | MELD01000084 |
Search identical group | |
Phylum/Class | Acidobacteriota |
Species | Acidobacteria bacterium RIFCSPLOWO2_12_FULL_67_14 [MELD] |
Start position on genome | 11685 |
End posion on genome | 11610 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gacgtttccT |
tRNA gene sequence |
GCCGGAGTAGCTCAGCCGGTTAGAGCACGCGTCTCATAAGCGCGGGGTCGGCGGTTCGAG |
Downstream region at tRNA end position |
caagtcccaa |
Secondary structure (Cloverleaf model) | >W1910697840 Met CAT T ATac caagtcccaa G - C C - G C - G G - C G - C A - T G - C T G T C C G C C A C G A A | | | | | G C C T C G G G C G G C G | | | | T T G G A G C T T A A GGGTC C - G G - C C - G G - C T + G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |