Sequence ID | >W1910702886 |
Genome ID | MEZF01000036 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Candidatus Bathyarchaeota archaeon RBG_13_52_12 [MEZF] |
Start position on genome | 15277 |
End posion on genome | 15191 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
atttggttga |
tRNA gene sequence |
GCCGGGGTCTCCTAGCTCGGTAGGGAGCCAGCCTGGAAAGCTGGTGTCCGTACGGACTCG |
Downstream region at tRNA end position |
actactataa |
Secondary structure (Cloverleaf model) | >W1910702886 Ser GGA a GCCA actactataa G - C C - G C - G G - C G - C G - C G + T T A T C T C C C A C G A C | | | | | G T T C C T G A G G G C C + | | | T T G G G G A G T A G TGTCCGTACGGACTC C - G C - G A - T G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |