Sequence ID | >C09104018 |
Genome ID | CP001336 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Desulfitobacterium hafniense DCB-2 [CP001336] |
Start position on genome | 5250552 |
End posion on genome | 5250477 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
agtgagtttt |
tRNA gene sequence |
GAGCCATTAGCTCAGTCGGTAGAGCACCTGACTTTTAATCAGGGTGTCCCGCGTTCGAGT |
Downstream region at tRNA end position |
ttatctatca |
Secondary structure (Cloverleaf model) | >C09104018 Lys TTT t ACCA ttatctatca G - C A - T G - C C - G C - G A - T T - A T G T G G C G C A T G A A | | | | | G C C T C G C C G C G C G | | | | T T G G A G C T A A GTGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |