| Sequence ID | >W1910714672 |
| Genome ID | MFTC01000010 |
| Phylum/Class | Unclassified |
| Species | Candidatus Muproteobacteria bacterium RIFCSPLOWO2_01_FULL_60_18 [MFTC] |
| Start position on genome | 29046 |
| End posion on genome | 29122 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
tcactttatg |
| tRNA gene sequence |
GTGAGCGTAGCTCAGTTGGTTAGAGTCCCGGATTGTGATTCCGGTTGTCGTGGGTTCGAG |
| Downstream region at tRNA end position |
gtttctttgg |
| Secondary structure (Cloverleaf model) | >W1910714672 His GTG
g CCCA gtttctttgg
G - C
T - A
G - C
A - T
G - C
C - G
G - C T G
T T A C C C A
T G A A + | | | | G
T C T C G G T G G G C
G | | | + T T
G G A G T
T T A C TTGTC
C - G
C - G
G - C
G - C
A - T
T T
T A
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |