Sequence ID | >W1910729320 |
Genome ID | MGYJ01000078 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Gammaproteobacteria bacterium RIFCSPHIGHO2_12_FULL_63_22 [MGYJ] |
Start position on genome | 170069 |
End posion on genome | 169993 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gcggctccct |
tRNA gene sequence |
CGGGGTGTAGCTCAGCCTGGTAGAGCGCTACGTTCGGGACGTAGAAGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
aagcatgttg |
Secondary structure (Cloverleaf model) | >W1910729320 Pro CGG t ACCA aagcatgttg C - G G - C G - C G - C G - C T T G - C T A T T G T C C A C G A A + | | | | G C C T C G G C A G G C T | | | | T T G G A G C G T A G AAGTC C - G T - A A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |