Sequence ID | >W1910749222 |
Genome ID | MIYT01000018 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Marine Group III euryarchaeote CG-Bathy2 [MIYT] |
Start position on genome | 6498 |
End posion on genome | 6423 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
cgaggacggc |
tRNA gene sequence |
GGGCCCGTGGGGTAGCTTGGCATCCTTGTGGCTTTGGGAGCCATTGACTCCCGTTCAAAT |
Downstream region at tRNA end position |
gcgcggaatg |
Secondary structure (Cloverleaf model) | >W1910749222 Pro TGG c ACCA gcgcggaatg G - C G - C G - C C - G C - G C - G G - C T A T A G G G C A C G A G | | | | | A T T G G G T C C C G C T | | + T T G T C C T G C A T TGAC G + T T - A G - C G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |