Sequence ID | >W1910758257 |
Genome ID | MLJY01000006 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Formosa algae KMM 8021 [MLJY] |
Start position on genome | 146644 |
End posion on genome | 146717 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
taccacaact |
tRNA gene sequence |
GCGAGAGTAGCTCAGTTGGTAGAGCGTCAGCCTTCCAAGCTGAATGTCGCCGGTTCGAAC |
Downstream region at tRNA end position |
agcgcttcat |
Secondary structure (Cloverleaf model) | >W1910758257 Gly TCC t TCaa agcgcttcat G - C C - G G - C A - T G - C A - T G - C C A T T G G C C A T G A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T A G ATGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |