Sequence ID | >W1910760412 |
Genome ID | MNFB01000069 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Thaumarchaeota archaeon 13_1_40CM_4_38_7 [MNFB] |
Start position on genome | 5980 |
End posion on genome | 5893 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
catggtgcaT |
tRNA gene sequence |
GCGGGAGTTGCCAAGCCTGGCCAAAGGCGCAGGGCTTAGGACCCTGTCTTTTAGGAGTTC |
Downstream region at tRNA end position |
aatgaactat |
Secondary structure (Cloverleaf model) | >W1910760412 Leu TAG T ATCt aatgaactat G - C C - G G - C G - C G - C A - T G - C T A T C A C C C A C C G A T | | | | | A T A C C G G T G G G C G | | | T T G A G G C C C A A G TCTTTTAGGAGTTC C - G A - T G - C G - C G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |