Sequence ID | >W1910760475 |
Genome ID | MNHP01000014 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Thaumarchaeota archaeon 13_1_40CM_2_39_4 [MNHP] |
Start position on genome | 1571 |
End posion on genome | 1646 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ctttaagcta |
tRNA gene sequence |
GCTCCTGTGGTGTAGTCCGGCTAAGCATACTGCCCTCTCAAGGCAGTGATCCCGGGTTCA |
Downstream region at tRNA end position |
catttttgat |
Secondary structure (Cloverleaf model) | >W1910760475 Glu CTC a Atat catttttgat G - C C - G T - A C - G C - G T + G G - C T A T G G C C C A C T G A G | | | | | A C T G T G C C G G G C G + | | + T T G G C A T C T A A A TGATC C - G T - A G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |