Sequence ID | >W1910760509 |
Genome ID | MNJS01000054 |
Search identical group | |
Phylum/Class | Nitrososphaerota |
Species | Thaumarchaeota archaeon 13_1_20CM_2_39_20 [MNJS] |
Start position on genome | 7700 |
End posion on genome | 7628 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tccatacgac |
tRNA gene sequence |
GGGCTGGTAGTTCAGCGGTAGAATACCCGCCTTGCACGCGGGGGGTCTGGGGTTCAAATC |
Downstream region at tRNA end position |
cgactgatga |
Secondary structure (Cloverleaf model) | >W1910760509 Ala TGC c ACtc cgactgatga G - C G - C G + T C - G T - A G - C G - C T A T A C C C C A G A A | | | | | A C C T T G T G G G G C G | | | + T T G G A A T T A A GGGTC C - G C - G C - G G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |