Sequence ID | >W1910760921 |
Genome ID | MNKX01000062 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Erwinia sp. OLMTSP26 [MNKX] |
Start position on genome | 4297 |
End posion on genome | 4381 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aatttggata |
tRNA gene sequence |
GGTGGGATTCCCGAGCGGCCAAAGGGAGCAGACTGTAAATCTGCCGTCACAGACTTCGAA |
Downstream region at tRNA end position |
ttcaaaccat |
Secondary structure (Cloverleaf model) | >W1910760921 Tyr GTA a ACCA ttcaaaccat G - C G - C T - A G - C G - C G - C A - T T A T C T T C C A C G A T | | | | | G G G C C C G A A G G C G | | | T T C A G G G C A A A CGTCACAGACTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |