Sequence ID | >W1910765788 |
Genome ID | MNVW01000021 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Candidatus Pacearchaeota archaeon CG1_02_31_27 [MNVW] |
Start position on genome | 6123 |
End posion on genome | 6038 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aagcataaaT |
tRNA gene sequence |
GCGGGAGTGCCGGAGCGGTCAAACGGGCTAGACTCAAGATCTAGTGGCTTAGTGCCTACG |
Downstream region at tRNA end position |
aaacttttaa |
Secondary structure (Cloverleaf model) | >W1910765788 Leu CAA T ATaa aaacttttaa G - C C - G G - C G - C G - C A C G - C C T T C T T C C A C G A G | | | | | G G G G C C G A A G G C G | | | T T T A C G G C A A G TGGCTTAGTGCCTAC C - G T - A A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |