Sequence ID | >W1910765860 |
Genome ID | MNVZ01000025 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Candidatus Pacearchaeota archaeon CG1_02_39_14 [MNVZ] |
Start position on genome | 25996 |
End posion on genome | 26070 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaacctttaa |
tRNA gene sequence |
GATCCCGTAGTTCAGCCCGGTTAGAACGCTGCTCTGATAAGGCAGAGGTCCCAAGTTCAA |
Downstream region at tRNA end position |
atattacaaa |
Secondary structure (Cloverleaf model) | >W1910765860 Ile GAT a Attc atattacaaa G - C A - T T - A C - G C - G C - G G - C T A T G G T T C A C C G A A | | | | | A C C T T G C C A A G C G | | | | T T G G A A C T T A G AGGTC C - G T - A G - C C - G T + G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |