Sequence ID | >W1910809175 |
Genome ID | MUGY01000002 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium hydatis ATCC 29551 [MUGY] |
Start position on genome | 69875 |
End posion on genome | 69947 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tacagaagca |
tRNA gene sequence |
GGCCCGTTCGTCTATCGGTTAGGACGCATGGTTTTCATCCATGTAAGAGCGGTTCGATTC |
Downstream region at tRNA end position |
cttttttttg |
Secondary structure (Cloverleaf model) | >W1910809175 Glu TTC a ACta cttttttttg G + T G - C C - G C - G C - G G - C T - A T T T T C G C C A C T A C | | | | | G G T C T G A G C G G C G + | | | T T T G G A C T A G TAAG C - G A - T T - A G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |