Sequence ID | >W1910809309 |
Genome ID | MUHA01000010 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium oncorhynchi CCUG 59446 [MUHA] |
Start position on genome | 29367 |
End posion on genome | 29296 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ggctttaatt |
tRNA gene sequence |
ACGGGCGTAGTTCAAGGGTAGAATAGCGGTCTCCAAAACCGTTGATGGGGGTTCGAATCC |
Downstream region at tRNA end position |
taaaaaaaac |
Secondary structure (Cloverleaf model) | >W1910809309 Trp CCA t GCaa taaaaaaaac A - T C - G G - C G - C G - C C - G G - C T A T C T C C C A A A A | + | | | G G C T T G G G G G G C G | | | + T T G G A A T T A A TGAT G + T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |