Sequence ID | >W1910810941 |
Genome ID | MUXF01000024 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Arcobacter lacus RW43-9 [MUXF] |
Start position on genome | 34077 |
End posion on genome | 34001 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tttatttggc |
tRNA gene sequence |
GCTGGTGTAGCTCAGTTGGCTAGAGCAGCTGATTTGTAATCAGCAGGTCGGGGGTTCGAC |
Downstream region at tRNA end position |
ttttttgtcg |
Secondary structure (Cloverleaf model) | >W1910810941 Thr TGT c TCCA ttttttgtcg G - C C - G T - A G - C G - C T - A G - C T C T T T C C C A T G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C C T A A AGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |