Sequence ID | >W1910813447 |
Genome ID | MVFR01000048 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Streptococcus agalactiae S89-MA [MVFR] |
Start position on genome | 28 |
End posion on genome | 111 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atttagaaaT |
tRNA gene sequence |
GCGGGTGTGGCGGAATTGGCAGACGCACCAGATTTAGGATCTGGCGCTTAACGGCGTGGG |
Downstream region at tRNA end position |
gtagattgcc |
Secondary structure (Cloverleaf model) | >W1910813447 Leu TAG T ATta gtagattgcc G - C C - G G - C G - C G - C T - A G - C T G T T T C C C A T A A G + + | | | A T G G C G G G G G G C G | | | T T G A C G C C A G A CGCTTAACGGCGT C - G C - G A - T G - C A - T T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |