Sequence ID | >C09100784 |
Genome ID | FM178379 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Aliivibrio salmonicida LFI1238 [FM178379, FM178380] |
Start position on genome | 1149170 |
End posion on genome | 1149080 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tcaccgcact |
tRNA gene sequence |
GGAGGGATGGCTGAGTGGTCGAAAGCACCGGTCTTGAAAACCGGCAACCGTTAATAGCGG |
Downstream region at tRNA end position |
ctttcgaaat |
Secondary structure (Cloverleaf model) | >C09100784 Ser TGA t ACCA ctttcgaaat G - C G - C A - T G - C G - C G - C A - T T A T A T C C C A T G A G | | | | | A G G T C G T A G G G C G | | | T T T A A G C C G A A CAACCGTTAATAGCGGTTC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |