Sequence ID | >W1910872239 |
Genome ID | NDFM01000105 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rothia sp. Olga [NDFM] |
Start position on genome | 198 |
End posion on genome | 270 |
Amino Acid | Ala |
Anticodon | AGC |
Upstream region at tRNA start position |
aagaaagtac |
tRNA gene sequence |
GGGCGTGTGGCGTAGTTGGTAGCGCGCTCCCTTAGCATGGGAGAGGTCTTGGGTTCGATT |
Downstream region at tRNA end position |
ttattttggt |
Secondary structure (Cloverleaf model) | >W1910872239 Ala AGC c Attt ttattttggt G - C G - C G + T C - G G - C T T G - C T T T A A C C C A T G A G | | | | | G T T G C G T T G G G C G + | | | T T G G C G C T A G AGGTC C - G T - A C - G C - G C - G T T T A A G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |