Sequence ID | >W1910889949 |
Genome ID | NEUB01000633 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Streptomyces sp. SM1 [NEUB] |
Start position on genome | 30525 |
End posion on genome | 30599 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
acgtcagcag |
tRNA gene sequence |
GCGCCGCTAGCTCAGTTGGTTAGAGCAGCTGACTCTTAATCAGCGGGTCCGGGGTTCGAG |
Downstream region at tRNA end position |
catgagtgag |
Secondary structure (Cloverleaf model) | >W1910889949 Lys CTT g ACga catgagtgag G - C C - G G - C C - G C - G G - C C - G T G T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |