Sequence ID | >W1910891378 |
Genome ID | NEWJ01000007 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorubrum sp. SD683 [NEWJ] |
Start position on genome | 33841 |
End posion on genome | 33917 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ggctacgtcg |
tRNA gene sequence |
AGCCCCGGAGTCTCCGCTGGCGAGGGACGCCGGACTTTGAATCCGGAAGTCGCCGGTTCG |
Downstream region at tRNA end position |
gccgacgtgg |
Secondary structure (Cloverleaf model) | >W1910891378 Gln TTG g ACat gccgacgtgg A G G - C C - G C - G C - G C - G G - C T T G C G G C C A C G C C A | | | | | G T T C T G G C C G G C G + | | | T T G G G A C C G A G G AAGTC C - G C - G G - C G - C A - T C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |