Sequence ID | >C09108704 |
Genome ID | AP008957 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus erythropolis PR4 [AP008957] |
Start position on genome | 308463 |
End posion on genome | 308552 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gatcgcccac |
tRNA gene sequence |
GGAAGCGTGGCAGAGCGGCCGAATGCACTCGCCTTGAAAGCGAGCGTGGCGTTAAACCCA |
Downstream region at tRNA end position |
aatgttcgtt |
Secondary structure (Cloverleaf model) | >C09108704 Ser TGA c GCCA aatgttcgtt G - C G - C A - T A - T G - C C - G G - C T A T C T C C C A C G A G | + | | | A G G A C G G G G G G C G | | | T T C A T G C C G A A CGTGGCGTTAAACCCACC C - G T - A C - G G - C C - G C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |