Sequence ID | >W1910911709 |
Genome ID | NHNZ01000173 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorubrum sp. C191 [NHNZ] |
Start position on genome | 655 |
End posion on genome | 571 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ggctcagtgT |
tRNA gene sequence |
GCCGTGACTGGGGAATGGTGACCCCACTGGCCTGCTACGCCAGCCCCGGCGACGGGTTCC |
Downstream region at tRNA end position |
tgccaacgaa |
Secondary structure (Cloverleaf model) | >W1910911709 Ser GCT T GTga tgccaacgaa G - C C - G C - G G - C T - A G - C A A T A C G G G C C A T A A T | | | | | G G G G G G C C C G G C G | | | | T T T C C C C G A A CCCCGGCGACGGGTT C - G T - A G - C G - C C - G C C T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |