Sequence ID | >W1910911936 |
Genome ID | NHOV01000474 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorubrum ezzemoulense LG1 [NHOV] |
Start position on genome | 88964 |
End posion on genome | 89045 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cacggagtga |
tRNA gene sequence |
GCCAGGATGGCCGAGTGGTAAGGCGCACGCCTGGAAAGCGTGTTCCCATCCGGGATCGGG |
Downstream region at tRNA end position |
tcgacgaacg |
Secondary structure (Cloverleaf model) | >W1910911936 Ser GGA a Gttt tcgacgaacg G - C C - G C - G A - T G - C G - C A - T T A T C T C C C A G A G | + | | | A T G C C G G G G G G C G | | | T T G A G G C T A G TTCCCATCCGGGATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |